Journal: bioRxiv

Article Title: Novel CHD8 genomic targets identified in fetal mouse brain by in vivo Targeted DamID

doi: 10.1101/2021.01.12.426468

Figure Lengend Snippet: ( A ) Plasmids used for TaDa. The top plasmid is a diagram for CHD8 TaDa experiments. The middle plasmid is a diagram for Dam-only experiments. The bottom plasmid is a diagram for the in utero electroporation control injected with the CHD8 TaDa or Dam-only plasmids. ( B ) Schematic and flowchart of TaDa-seq experiments. E13.5 mouse embryos were injected with CHD8 TaDa or Dam-only plasmid and the in utero electroporation control plasmid. Four CHD8 TaDa and three Dam-only brains from the same litter were dissected. Frozen brains were then processed for the pipeline indicated in the grey boxes. ( C ) Immunohistochemistry showing overlap between green fluorescence (in utero electroporation control), red fluorescence (mCherry expression upstream of the CHD8 TaDa open reading frame), and DAPI (nuclei) illustrates successful transfection of experimental plasmids. ( D ) TaDa-seq computational analysis pipeline used in this study. ( E ) Schematic showing example signal from CHD8 TaDa or Dam-only protein binding at genomic loci.

Article Snippet: To generate the experimental plasmid, pCAG-mCherry-intronDam-CHD8, encoding the Dam methylase fused to the human CHD8 open reading frame (hereafter CHD8 TaDa), a full-length CHD8 isoform (Origene, RG230753) was subcloned by Gibson assembly into pCAG-mCherry-intronDam, C-terminal to the Dam methylase and a myc-tag.

Techniques: Plasmid Preparation, In Utero, Electroporation, Control, Injection, Immunohistochemistry, Fluorescence, Expressing, Transfection, Protein Binding

Journal: bioRxiv

Article Title: Novel CHD8 genomic targets identified in fetal mouse brain by in vivo Targeted DamID

doi: 10.1101/2021.01.12.426468

Figure Lengend Snippet: Data showing CHD8 binding at loci previously identified in CHD8 binding characterization studies, including RNA processing genes, Hnrnpll and Srsf7 in panel A, Srsf1 and Sf3b1 in panel B, and a chromatin remodeling gene, Top1 , in panel B. Grey boxes highlight CHD8 binding near identified promoters of interest. CHD8 TaDa, Dam-only, or Dam-only normalized CHD8 TaDa (TaDa Dam Norm.) experiment tracks are in blue (representative biological replicates shown), CHD8 ChIP-seq experiments are in grey, and datasets of histone and chromatin accessibility signatures from the ENCODE consortium are in black. Linear representations of genes from the mouse mm10 genome are shown below coverage tracks. Height of the y-axis is scaled to show the peak for each track separately.

Article Snippet: To generate the experimental plasmid, pCAG-mCherry-intronDam-CHD8, encoding the Dam methylase fused to the human CHD8 open reading frame (hereafter CHD8 TaDa), a full-length CHD8 isoform (Origene, RG230753) was subcloned by Gibson assembly into pCAG-mCherry-intronDam, C-terminal to the Dam methylase and a myc-tag.

Techniques: Binding Assay, ChIP-sequencing

Journal: bioRxiv

Article Title: Novel CHD8 genomic targets identified in fetal mouse brain by in vivo Targeted DamID

doi: 10.1101/2021.01.12.426468

Figure Lengend Snippet: ( A ) Bar plots showing association of peaks with transcription start sites (TSS) using the GREAT online analysis tool. Bins along the x-axis represent 5, 50, 500, and greater than 500 kilobases away from the nearest TSS. ( B ) Genome-wide coverage heatmaps showing enrichment of signal at peaks for each dataset indicated on the left-hand side. Y axis of datasets were matched for visual comparison. Small line plots indicate the average normalized peak enrichment for each dataset with the color for each line next to each dataset name. Each peak is centered along the middle of each plot with a 3 kilobase pair window on each side. The legend indicates normalized enrichment. ( C ) Venn diagram showing the number of peaks annotated to genes overlapping with CHD8 TaDa, Embryonic CHD8 ChIP-seq, and Adult CHD8 ChIP-seq using stringent CHD8 TaDa-seq peak thresholding with peaks meeting an FDR < 0.00001 cutoff in at least 3 replicates (Top) or a looser threshold of peaks present in at least 3 replicates (Bottom). ( D ) Genome coverage correlation heatmap showing relationship between representative CHD8 TaDa-seq, Dam-only, CHD8 ChIP-seq, and ENCODE histone mark and chromatin accessibility datasets. Data are hierarchically clustered according to genome-wide similarity as indicated by a dendrogram. Legend indicates the correlation value between datasets. H3K27me3 is a histone mark associated with repressed DNA loci. H3K4me3 is a histone mark associated with actively transcribed promoters. ATAC-seq is sequencing data of open chromatin regions. H3K4me1 and H3K27ac are histone marks associated with putative enhancers. ( E ) Table showing functional annotations associated with CHD8 TaDa-seq called peaks. Region % refers to the percent of the total peak set annotated to each term.

Article Snippet: To generate the experimental plasmid, pCAG-mCherry-intronDam-CHD8, encoding the Dam methylase fused to the human CHD8 open reading frame (hereafter CHD8 TaDa), a full-length CHD8 isoform (Origene, RG230753) was subcloned by Gibson assembly into pCAG-mCherry-intronDam, C-terminal to the Dam methylase and a myc-tag.

Techniques: Genome Wide, Comparison, ChIP-sequencing, Sequencing, Functional Assay

Journal: bioRxiv

Article Title: Novel CHD8 genomic targets identified in fetal mouse brain by in vivo Targeted DamID

doi: 10.1101/2021.01.12.426468

Figure Lengend Snippet: HOMER results of the top 30 motifs identified in CHD8 TaDa-seq peaks. Target sequences refer to sequences from CHD8 TaDa-seq peaks used as input. Background sequences refers to random sequence-content matched intervals in the genome.

Article Snippet: To generate the experimental plasmid, pCAG-mCherry-intronDam-CHD8, encoding the Dam methylase fused to the human CHD8 open reading frame (hereafter CHD8 TaDa), a full-length CHD8 isoform (Origene, RG230753) was subcloned by Gibson assembly into pCAG-mCherry-intronDam, C-terminal to the Dam methylase and a myc-tag.

Techniques: Sequencing

Journal: bioRxiv

Article Title: Novel CHD8 genomic targets identified in fetal mouse brain by in vivo Targeted DamID

doi: 10.1101/2021.01.12.426468

Figure Lengend Snippet: Genome coverage correlation heatmap showing relationship between CHD8 TaDa-seq replicates, Chd8 ChIP-seq replicates, and ENCODE histone mark and chromatin accessibility dataset replicates. Data are hierarchically clustered according to similarity as indicated by a dendrogram. Differences in signal intensity between CHD8 TaDa-seq replicates in the correlation heatmaps were due to differences in sequencing depth. The legend indicates the correlation value between datasets. H3K27me3 is a histone mark associated with repressed DNA loci. H3K4me3 is a histone mark associated with actively transcribed promoters. ATAC-seq identifies regions of open chromatin. H3K4me1 and H3K27ac are histone marks associated with putative enhancers. CHD8 TaDa Merge – Merged CHD8 TaDa-seq dataset. Dam-only Merge – Merged Dam-only dataset.

Article Snippet: To generate the experimental plasmid, pCAG-mCherry-intronDam-CHD8, encoding the Dam methylase fused to the human CHD8 open reading frame (hereafter CHD8 TaDa), a full-length CHD8 isoform (Origene, RG230753) was subcloned by Gibson assembly into pCAG-mCherry-intronDam, C-terminal to the Dam methylase and a myc-tag.

Techniques: ChIP-sequencing, Sequencing

Journal: bioRxiv

Article Title: Novel CHD8 genomic targets identified in fetal mouse brain by in vivo Targeted DamID

doi: 10.1101/2021.01.12.426468

Figure Lengend Snippet: ( A ) Box and whisker plots showing comparison between CHD8 TaDa-seq peak rank and an E17.5 Chd8 haploinsufficiency differential gene expression dataset. Change in log fold counts per million of genes according to CHD8 binding (Left). Change in log fold change of genes according to CHD8 binding (Right). Boxes were plotted according to CHD8 binding affinity bins: all genes meeting at least 0.1 count per million sequencing coverage (Expressed Genes), any genes having CHD8 binding (All Bound Genes), and the top 1000 genes near CHD8 peaks (Top 1000 Bound). Notches indicate values within the 95% confidence interval of the median. ( B ) Box and whisker plots showing comparison between Dam-only peak rank and an E17.5 Chd8 haploinsufficiency differential gene expression dataset. Change in log fold counts per million of genes according to Dam binding (Left). Change in log fold change of genes according to Dam binding (Right). Boxes were plotted according to CHD8 binding affinity bins: all genes meeting at least 0.1 count per million sequencing coverage (Expressed Genes), any genes having CHD8 binding (All Bound Genes), and top 1000 genes near CHD8 peaks (Top 1000 Bound). Notches indicate values within the 95% confidence interval of the median. ( C-D left ) Venn diagrams indicating the number of genes overlapping between the CHD8 TaDa-seq and E17.5 Chd8 haploinsufficiency significant (p < 0.05) downregulated and upregulated datasets. ( C-D right ) Tables showing functional annotations associated with genes having CHD8 binding in downregulated (C) and upregulated (D) genes from the E17.5 Chd8 haploinsufficiency dataset (p < 0.05) using goseq. Enrichment values indicate the percent of genes in the dataset that are differentially expressed and bound by CHD8 via TaDa-seq in relation to the total number of genes associated with each term.

Article Snippet: To generate the experimental plasmid, pCAG-mCherry-intronDam-CHD8, encoding the Dam methylase fused to the human CHD8 open reading frame (hereafter CHD8 TaDa), a full-length CHD8 isoform (Origene, RG230753) was subcloned by Gibson assembly into pCAG-mCherry-intronDam, C-terminal to the Dam methylase and a myc-tag.

Techniques: Whisker Assay, Comparison, Gene Expression, Binding Assay, Sequencing, Functional Assay

Journal: bioRxiv

Article Title: Novel CHD8 genomic targets identified in fetal mouse brain by in vivo Targeted DamID

doi: 10.1101/2021.01.12.426468

Figure Lengend Snippet: ( A-C ) CHD8 binding near genes important for regulation of neuronal gene expression, Myt1l (A), and synaptic function, Ank3 (B) and Dlg4 (C). Grey boxes highlight CHD8 binding near select promoter and distal regions of interest overlapping with putative enhancer marks (H3K27ac and H3K4me1). CHD8 TaDa-seq experiment tracks are in blue, CHD8 ChIP-seq experiments are in grey, and datasets of histone and chromatin accessibility signatures from the ENCODE consortium are in black. Linear representations of genes from the mouse mm10 genome are shown below coverage tracks. Height of the y-axis is scaled to show the peak for each track separately. ( D ) Table showing functional annotations associated with promoter proximal (<1kb from TSS) (Top) and promoter distal (Bottom) regions. Rank refers to the rank within the dataset. A rank of 1 would mean the annotation with the smallest FDR value (aka the most significant). Region hits capture the number of peaks associated with each term. Region % captures the percent of regions captured compared to the total number of peaks.

Article Snippet: To generate the experimental plasmid, pCAG-mCherry-intronDam-CHD8, encoding the Dam methylase fused to the human CHD8 open reading frame (hereafter CHD8 TaDa), a full-length CHD8 isoform (Origene, RG230753) was subcloned by Gibson assembly into pCAG-mCherry-intronDam, C-terminal to the Dam methylase and a myc-tag.

Techniques: Binding Assay, Gene Expression, ChIP-sequencing, Functional Assay

Journal: bioRxiv

Article Title: Novel CHD8 genomic targets identified in fetal mouse brain by in vivo Targeted DamID

doi: 10.1101/2021.01.12.426468

Figure Lengend Snippet: Table showing functional annotations associated with peaks in CHD8 ChIP-seq datasets. Region hits capture the number of peaks associated with each term. Region % captures the percent of regions captured compared to the total number of peaks.

Article Snippet: To generate the experimental plasmid, pCAG-mCherry-intronDam-CHD8, encoding the Dam methylase fused to the human CHD8 open reading frame (hereafter CHD8 TaDa), a full-length CHD8 isoform (Origene, RG230753) was subcloned by Gibson assembly into pCAG-mCherry-intronDam, C-terminal to the Dam methylase and a myc-tag.

Techniques: Functional Assay, ChIP-sequencing

Journal: Cell

Article Title: Pyramidal neurons form active, transient, multilayered circuits perturbed by autism-associated mutations at the inception of neocortex

doi: 10.1016/j.cell.2023.03.025

Figure Lengend Snippet: Perturbing autism-associated genes selectively in Rbp4-Cre neurons disrupts circuit organization and activity during embryonic development (A) Expression (circles) of selected genes associated with autism spectrum disorder in the three Rbp4-Cre neuron types and adult L5-PN types. Radius of circles: fraction of cells expressing the gene; color of circles: mean normalized transcripts per cell (log 2 ). (B) Fraction of genes with a mean transcript count greater than the number of transcripts shown on the x axis, for all genes (black), and genes associated with autism spectrum disorder (magenta) in Rbp4-Cre neurons (top) and adult L5-PNs (bottom). Inset: Fold change of autism-associated gene expression compared to all genes in embryos and adult. (C) Immunostaining of cortex of Rbp4-tdTomato-Chd8 +/− (top) and Rbp4-tdTomato-Grin2b +/− (bottom) mice ( Figure S8 ). Rbp4-Cre neurons (red), Bcl11b, (white), Hoechst (blue). (D) Normalized depths of Rbp4-Cre neurons (as in Figure 2 A) in Rbp4-tdTomato (WT) and the two mutant (top, Chd8 +/− ; bottom, Grin2b +/− ) embryos ( Figure S9 ). 125 neurons from each mouse line, sampled at random. χ 2 test. (E) Mating strategy to generate Rbp4-GCaMP6s-tTA2-Chd8 +/− (Chd8 +/− ) and Rbp4-GCaMP6s-tTA2-Grin2b +/− (Grin2b +/− ) embryos. (F) Example recordings from Rbp4-Cre neurons’ dendrites in Rbp4-GCaMP6s-tTA2 (WT), Grin2b +/− , and Chd8 +/− embryos at E16.5 using 3D acousto-optic two-photon microscope. (G) Distribution of activity in E16.5 embryos, shown in log-scale, for WT and two mutant genotypes. Circles: activity of each neurite; red line: median; shading: distribution. Wilcoxon rank-sum test. n = number of neurites. (H) Immunostaining of local patches of cortical disorganization in Rbp4-tdTomato-Chd8 +/− and Rbp4-tdTomato-Grin2b +/− mice, at E18.5. Rbp4-Cre neurons (red), Bcl11b, (white), Hoechst (blue). (I) Fraction of mutant mice, of each genotype, showing at least one patch, summed across E16.5 to E18.5. Red line: Average across all four genotypes. Data from 14 (Rbp4-tdTomato-Chd8 +/− ), 11 (Rbp4-tdTomato-Chd8 −/− ), 9 (Rbp4-tdTomato-Grin2b +/− ), and 6 (Rbp4-tdTomato-Grin2b −/− ) embryos. Fisher’s exact test (p = 0.05, prior to Bonferroni correction). (J) Fraction of neurons within the superficial layer that are located within patches of disorganization, in embryos with at least one patch. n = number of superficial layer neurons on each embryonic day. Scale bars: 20 μm (C), 25s and 25 %ΔF/F (F), 50 μm (H). See also Figures S8 and .

Article Snippet: Chd8 Reverse: TCATCTGTCCTGCACCTTAAGG , Microsynth , N/A.

Techniques: Activity Assay, Expressing, Gene Expression, Immunostaining, Mutagenesis, Microscopy

Journal: Cell

Article Title: Pyramidal neurons form active, transient, multilayered circuits perturbed by autism-associated mutations at the inception of neocortex

doi: 10.1016/j.cell.2023.03.025

Figure Lengend Snippet: Crossing floxed Chd8 and Grin2b mouse lines with Rbp4-Cre results in the conditional knockout of Chd8 and Grin2b in Rbp4-Cre neurons, related to Figure 7 (A) Schematic of strategy to demonstrate Cre-mediated excision and resulting selective knockout of Chd8 and Grin2b in E18.5 Rbp4-tdTomato-Chd8 −/− or Rbp4-tdTomato-Grin2b −/− embryos. (B and C) Schematic diagram of Chd8 (B) and Grin2b (C) transcripts (Chd8: Ensembl 212; Grin2b: Ensembl 202), with approximate location of inserted loxP sites, region amplified in D and E (and sequenced in F and G), translational start sites, and translation end sites. Introns not shown to scale. (D and E) Regions within Chd8 (D) and Grin2b (E) genes, including the loxP sites, were PCR amplified and electrophoretically separated. Above: genotype of embryo for Cre and either floxed Chd8 or Grin2b; ref. wt: commercial mouse genomic DNA. Inset: Zoom in (with increased contrast) showing one example of each genotype and examples of longer (red) and shorter (blue) bands, with relative intensity in agreement with the presence of a small fraction of Cre-expressing cells (i.e. weaker band of the shorter fragment) and a large fraction of cells not expressing Cre (i.e. stronger band of the longer fragment) in the cortical samples. (F and G) Aligned sequences of excised bands from D and E. Red: sequence of Chd8 (F) and Grin2b (G) bands from longer fragment (derived from cells not expressing Cre) (yellow overlay: loxP sites); blue: sequence of bands from shorter fragment (derived from cells with Cre expression) (blue box: excised region). (H and I) Left: In situ hybridization of probes against Chd8 (H) or Grin2b (I) (green) and tdTomato (red: marking Rbp4-Cre neurons) in E18.5 Rbp4-tdTomato-Chd8 −/− (H) or Rbp4-tdTomato-Grin2b −/− (I) embryos. Example Cre-positive (dashed circles: tdTomato-expressing) and Cre-negative cells (solid circles: lacking tdTomato expression). Right: Number of puncta per cell in Cre-positive compared to Cre-negative cells (mean ± sem). n = 25 cells of each type. (J and K) Left: Immunostaining against Chd8 (J) or Grin2b (K) (green) and tdTomato (red: marking Rbp4-Cre neurons) in E18.5 Rbp4-tdTomato-Chd8 −/− (J) or Rbp4-tdTomato-Grin2b −/− (K) embryos. Example Cre-positive (dashed circles: tdTomato-expressing) and Cre-negative cells (solid circles: lacking tdTomato expression). Right: Quantification of change in fluorescence between Cre-positive cells compared to Cre-negative cells (mean ± sem). Fluorescence was normalized by mean fluorescence within Cre-negative neurons in each slice. n = 50 cells (J) and 30 cells (K) of each type. (H–K) Probability: Wilcoxon rank-sum test. Scale bars: 10 μm (H–K).

Article Snippet: Chd8 Reverse: TCATCTGTCCTGCACCTTAAGG , Microsynth , N/A.

Techniques: Knock-Out, Amplification, Expressing, Sequencing, Derivative Assay, In Situ Hybridization, Immunostaining, Fluorescence

Journal: Cell

Article Title: Pyramidal neurons form active, transient, multilayered circuits perturbed by autism-associated mutations at the inception of neocortex

doi: 10.1016/j.cell.2023.03.025

Figure Lengend Snippet: Perturbing autism-associated genes selectively in Rbp4-Cre neurons disrupts organization of layer 5 during embryonic development, related to Figure 7 (A) Rbp4-Cre neurons (stained using tdTomato antibody, red) in Rbp4-tdTomato-Chd8 −/− (top) and Rbp4-tdTomato-Grin2b −/− (blue) mice, from E14.5 to E18.5, within the cortical plate (magenta), subplate (cyan), and intermediate zone (yellow), counterstained with Hoechst (blue). (B) Distribution of Rbp4-Cre neuronal locations as a fraction of the cortical plate and subplate thickness, from E14.5 to E18.5, in control (WT, black), Rbp4-tdTomato-Chd8 −/− (top, green), and Rbp4-tdTomato-Grin2b −/− (bottom, orange) mice. 85 neurons from each mouse line, sampled at random, displayed on each embryonic day. Layer boundaries derived from Figure 2 A (blue: superficial layer; gray: intermediate layer; beige: deep layer). Probability: χ 2 test comparing the fraction of Rbp4-Cre neurons in each layer between the conditional knockout mouse and control mice, on each embryonic day; p = 0.05. (C) Local patches of disorganization in Rbp4-tdTomato-Chd8 and Rbp4-tdTomato-Grin2b conditional knockout (cKO) mice (examples from each embryonic day from E16.5 to E18.5) show Rbp4-Cre neurons (stained using tdTomato antibody, red) at the surface and disrupted intermediate layer, including both neurons expressing Cre (red) and not expressing Cre (stained using Bcl11b antibody, white), counterstained with Hoechst (blue). (D) Superficial layer Rbp4-Cre neurons in E18.5 control mouse, without disorganization of the underlying intermediate layer. Scale bar: Scale bar: 20 μm (A, C, D).

Article Snippet: Chd8 Reverse: TCATCTGTCCTGCACCTTAAGG , Microsynth , N/A.

Techniques: Staining, Control, Derivative Assay, Knock-Out, Expressing

Journal: Cell

Article Title: Pyramidal neurons form active, transient, multilayered circuits perturbed by autism-associated mutations at the inception of neocortex

doi: 10.1016/j.cell.2023.03.025

Figure Lengend Snippet:

Article Snippet: Chd8 Reverse: TCATCTGTCCTGCACCTTAAGG , Microsynth , N/A.

Techniques: Virus, Recombinant, Electron Microscopy, RNAscope, Multiplex Assay, Gene Expression, Plasmid Preparation, Sequencing, Positive Control, Negative Control, Software, RNA Sequencing, Transmission Assay, Microscopy, Laser-Scanning Microscopy, Imaging

Journal: Cell & Bioscience

Article Title: Critical roles of microRNA-141-3p and CHD8 in hypoxia/reoxygenation-induced cardiomyocyte apoptosis

doi: 10.1186/s13578-020-00384-5

Figure Lengend Snippet: Primers used for qRT-PCR

Article Snippet: The miR-141-3p mimics and miR-141-3p NC sequences used are as follows: miR-141-3p mimics: 5′-UAACACUGUCUGGUAAAGAUGG-3′; miR-141-3p negative control: 5′-ACGUGACACGUUCGGAGAATT-3′; Similarly, to knockdown the expression of CHD8, siRNA oligonucleotides against CHD8 and negative control siRNA (NC-Si) were designed and synthesized by the RiboBio Co., Ltd. (Guangzhou, China).

Techniques: Sequencing

Journal: Cell & Bioscience

Article Title: Critical roles of microRNA-141-3p and CHD8 in hypoxia/reoxygenation-induced cardiomyocyte apoptosis

doi: 10.1186/s13578-020-00384-5

Figure Lengend Snippet: Antibodies used for Western blotting

Article Snippet: The miR-141-3p mimics and miR-141-3p NC sequences used are as follows: miR-141-3p mimics: 5′-UAACACUGUCUGGUAAAGAUGG-3′; miR-141-3p negative control: 5′-ACGUGACACGUUCGGAGAATT-3′; Similarly, to knockdown the expression of CHD8, siRNA oligonucleotides against CHD8 and negative control siRNA (NC-Si) were designed and synthesized by the RiboBio Co., Ltd. (Guangzhou, China).

Techniques: Western Blot

Journal: Cell & Bioscience

Article Title: Critical roles of microRNA-141-3p and CHD8 in hypoxia/reoxygenation-induced cardiomyocyte apoptosis

doi: 10.1186/s13578-020-00384-5

Figure Lengend Snippet: CHD8 is upregulated by H/R in H9c2 cardiomyocytes. H9c2 cardiomyocytes were subjected to hypoxia treatment for 8 h, then reoxygenated for 48 h as in Fig. . a The expression of CHD8, Cl-caspase-3, and caspase-3 was examined by Western blot. b CHD8 miRNA expression was determined by qRT-PCR. N = 3 per group. * P < 0.05, ** P < 0.01, compared with control group

Article Snippet: The miR-141-3p mimics and miR-141-3p NC sequences used are as follows: miR-141-3p mimics: 5′-UAACACUGUCUGGUAAAGAUGG-3′; miR-141-3p negative control: 5′-ACGUGACACGUUCGGAGAATT-3′; Similarly, to knockdown the expression of CHD8, siRNA oligonucleotides against CHD8 and negative control siRNA (NC-Si) were designed and synthesized by the RiboBio Co., Ltd. (Guangzhou, China).

Techniques: Expressing, Western Blot, Quantitative RT-PCR, Control

Journal: Cell & Bioscience

Article Title: Critical roles of microRNA-141-3p and CHD8 in hypoxia/reoxygenation-induced cardiomyocyte apoptosis

doi: 10.1186/s13578-020-00384-5

Figure Lengend Snippet: Knockdown of CHD8 inhibits apoptosis induced by H/R in H9c2 cardiomyocytes. H9c2 cardiomyocytes were transfected with CHD8-siRNA (CHD8-Si) or negative control-siRNA (NC-Si) for 6 h in low glucose DMEM, then cultured for another 48 h in basic DMEM. Transfected H9c2 cardiomyocytes were subjected to hypoxia treatment for 8 h, then reoxygenated for 48 h as in Fig. . a The expression of Cl-caspase-3 and caspase-3 was determined by Western blot. b Apoptotic cells were determined by flow cytometric analysis. N = 3 per group. * P < 0.05, ** P < 0.01, compared with indicated groups

Article Snippet: The miR-141-3p mimics and miR-141-3p NC sequences used are as follows: miR-141-3p mimics: 5′-UAACACUGUCUGGUAAAGAUGG-3′; miR-141-3p negative control: 5′-ACGUGACACGUUCGGAGAATT-3′; Similarly, to knockdown the expression of CHD8, siRNA oligonucleotides against CHD8 and negative control siRNA (NC-Si) were designed and synthesized by the RiboBio Co., Ltd. (Guangzhou, China).

Techniques: Knockdown, Transfection, Negative Control, Cell Culture, Expressing, Western Blot

Journal: Cell & Bioscience

Article Title: Critical roles of microRNA-141-3p and CHD8 in hypoxia/reoxygenation-induced cardiomyocyte apoptosis

doi: 10.1186/s13578-020-00384-5

Figure Lengend Snippet: MiR-141-3p interacts with CHD8 in H9c2 cardiomyocytes. H9c2 cardiomyocytes were transfected with miR-141-3p mimics or miR-141-3p NC for 6 h in low glucose DMEM, then cultured for another 48 h in basic DMEM. CHD8 expression was examined by Western blot ( a ) and qRT-PCR ( b ). c H9c2 cardiomyocytes were transfected with CHD8-siRNA (CHD8-Si) or negative control-siRNA (NC-Si) for 6 h in low glucose DMEM, then cultured for another 48 h in basic DMEM. The expression of miR-141-3p was examined by qRT-PCR. The relationship between miR-141-3p and CHD8 was determined by RIP analysis (d, e). Collected H9c2 cardiomyocytes were extracted by RIPA lysis buffer. Obtained samples were pre-incubated with protein A/G PLUS-agarose. The samples were then divided into two parts equally and incubated with IgG and CHD8 overnight separately. Washed samples and then divided each sample into two parts, one for Western blot analysis and the other for qPCR analysis. d The expression level of miR-141-3p was measured by qRT-PCR. e The protein expression level of CHD8 was examined by Western blot analysis. N = 3 per group. NC negative control. * P < 0.05, ** P < 0.01, compared with indicated groups

Article Snippet: The miR-141-3p mimics and miR-141-3p NC sequences used are as follows: miR-141-3p mimics: 5′-UAACACUGUCUGGUAAAGAUGG-3′; miR-141-3p negative control: 5′-ACGUGACACGUUCGGAGAATT-3′; Similarly, to knockdown the expression of CHD8, siRNA oligonucleotides against CHD8 and negative control siRNA (NC-Si) were designed and synthesized by the RiboBio Co., Ltd. (Guangzhou, China).

Techniques: Transfection, Cell Culture, Expressing, Western Blot, Quantitative RT-PCR, Negative Control, Lysis, Incubation

Journal: Cell & Bioscience

Article Title: Critical roles of microRNA-141-3p and CHD8 in hypoxia/reoxygenation-induced cardiomyocyte apoptosis

doi: 10.1186/s13578-020-00384-5

Figure Lengend Snippet: MiR-141-3p and CHD8 reduce the expression level of p21 in H9c2 cardiomyocytes. H9c2 cardiomyocytes were transfected with miR-141-3p mimics or CHD8-Si for 6 h in low glucose DMEM, then cultured for another 48 h in basic DMEM. a P21 expression was examined by Western blot. b The expression of p21 and CHD8 was determined by Western blot. After transfected with miR-141-3p mimics or CHD8-Si as a, b, H9c2 cardiomyocytes were subjected to hypoxia treatment for 8 h, then reoxygenated for 48 h as in Fig. . c , d P21 expression was examined by Western blot. N = 3 per group. * P < 0.05, ** P < 0.01, compared with indicated groups

Article Snippet: The miR-141-3p mimics and miR-141-3p NC sequences used are as follows: miR-141-3p mimics: 5′-UAACACUGUCUGGUAAAGAUGG-3′; miR-141-3p negative control: 5′-ACGUGACACGUUCGGAGAATT-3′; Similarly, to knockdown the expression of CHD8, siRNA oligonucleotides against CHD8 and negative control siRNA (NC-Si) were designed and synthesized by the RiboBio Co., Ltd. (Guangzhou, China).

Techniques: Expressing, Transfection, Cell Culture, Western Blot

Journal: Communications Biology

Article Title: Chd8 regulates X chromosome inactivation in mouse through fine-tuning control of Xist expression

doi: 10.1038/s42003-021-01945-1

Figure Lengend Snippet: a Overlap between Chd8 and H3K4me3 peaks; top undifferentiated (Und) and bottom differentiated conditions (Dif) from two biological experiments. b Heatmaps showing the distribution of Chd8 and H3K4me3 peaks in the genome (left). Association of Chd8 peaks with transcriptional start sites (TSS); top undifferentiated, bottom differentiated conditions (right). Data from two biological replicas is shown. c Genomic features distribution of Chd8 consensus peak sets; top undifferentiated, bottom differentiated conditions. Selected-features are shown (e.g. Promoters, Immediate downstream region (ImDown), etc.). Data from two biological experiments is shown. d Chd8 distribution at aligned sequence reads at the Xist and Tsix promoter regions. Black arrows indicate Chd8 peaks at the Xist promoter. A single representative set of ChIP-seq profiles is shown. Red: Chd8, green: H3K4me3, grey: IgG, black: input. Samples and antibodies used are indicated in the figure.

Article Snippet: We purchased the FL Chd8 cDNA from Genescript and cloned it into the MreI and NotI sites of pCAGp292-Puro.

Techniques: Sequencing, ChIP-sequencing

Journal: Communications Biology

Article Title: Chd8 regulates X chromosome inactivation in mouse through fine-tuning control of Xist expression

doi: 10.1038/s42003-021-01945-1

Figure Lengend Snippet: a CTRL-normalised Chd8 qRT-PCR at 3-day differentiated cells in CTRL and Chd8 KD cells is shown. CRTL: scrambled siRNA control (black bars), Chd8 KD : specific siRNA pool to Chd8 (red bars). Data from three independent experiments is shown. b CTRL-normalised Xist and Tsix qPCR at 3-day differentiated cells in CTRL and Chd8 KD cells is shown. CRTL: scrambled siRNA control (black bars), Chd8 KD : specific siRNA pool to Chd8 (red bars). Data from three independent experiments is shown. c Selected differentiation markers used for qRT-PCR analysis are shown. Data is normalised for the undifferentiated condition (Und). Data from two independent experiments is shown. d Xist -mediated gene silencing is not affected in Chd8 KD (two randomly selected X-linked genes are showed). Data is normalised for the undifferentiated condition (Und). Data from two independent experiments is shown. Und (undifferentiated cells), Dif (3 day differentiated cells). Error bars represent standard error of the mean (SEM). Statistical significance was tested by means of two-tailed unpaired t -test (* p ≤ 0.05; ** p ≤ 0.01). p -values, Xist = 0.00141, Chd8 = 0.00390. Single points represent independent biological samples. Gapdh was used as internal normalization control.

Article Snippet: We purchased the FL Chd8 cDNA from Genescript and cloned it into the MreI and NotI sites of pCAGp292-Puro.

Techniques: Quantitative RT-PCR, Control, Two Tailed Test

Journal: Communications Biology

Article Title: Chd8 regulates X chromosome inactivation in mouse through fine-tuning control of Xist expression

doi: 10.1038/s42003-021-01945-1

Figure Lengend Snippet: a Schematic representation of Chd8 protein domains; red lines indicate the position of the CRISPR/Cas9 guides used (not in scale). b Western Blot analysis of Chd8 KO.1 (clone C4.1) and parental ES cells (CTRL, Fa2L-S4) are shown. c qRT-PCR results showing expression levels of Xist, Tsix , Nestin , Sox2 . In differentiating ESCs Xist is strongly up-regulated in Chd8 KO cells whilst cell differentiation is not affected ( Nestin , Nanog); CTRL, parental cell line: Fa2L-S4; KO, sub-clone C4.1. Data is normalised for the undifferentiated condition (Und). Data from three independent experiments is shown. p -values, Xist = 0.0367. d Xist qRT-PCR data from parental (CTRL) and KO.1 cells in undifferentiated state is shown. Und (undifferentiated cells), Dif (3 day differentiated cells). Data from three independent experiments is shown. Error bars represent standard error of the mean (SEM). Statistical significance was tested by means of two-tailed unpaired t -test (* p ≤ 0.05; ** p ≤ 0.01). p -values, Xist = 0.00362. Single points represent independent biological sample. Gapdh was used as internal normalization control. e Representative images of H3K27me3 in CTRL vs. Chd8 KO cells (left) and the normalised scoring of H3K27me3 domains (IF) is shown (right), n = 658. Data from three independent experiments is shown. Error bars represent standard error of the mean (SEM). Statistical significance was tested by means of two-tailed unpaired t -test (* p ≤ 0.05; ** p ≤ 0.01). CTRL vs. KO.1, p -value = 0.0463. Single points represent independent biological samples.

Article Snippet: We purchased the FL Chd8 cDNA from Genescript and cloned it into the MreI and NotI sites of pCAGp292-Puro.

Techniques: CRISPR, Western Blot, Quantitative RT-PCR, Expressing, Cell Differentiation, Two Tailed Test, Control

Journal: Communications Biology

Article Title: Chd8 regulates X chromosome inactivation in mouse through fine-tuning control of Xist expression

doi: 10.1038/s42003-021-01945-1

Figure Lengend Snippet: Zoom-in on the XIC around the Xist and Tsix genes. In black the parental cell line and in red two representative KO cell lines (C4.1/C4.3 sub-clones). Undifferentiated and differentiating ES cells are shown (Und/Dif). Light-blue arrows indicate changes in chromatin structure at the Xist promoter in differentiating cells. A black box surrounds the Tsix and Jpx main regulatory regions, indicates no change of chromatin structure. Green arrows indicate chromatin changes around the Tsix promoter/ Tsix intron and Xist promoter, (CTRL, parental cell line: Fa2L-S4; Chd8 KO.1, sub-clone C4.1; Chd8 KO.2, sub-clone C4.3).

Article Snippet: We purchased the FL Chd8 cDNA from Genescript and cloned it into the MreI and NotI sites of pCAGp292-Puro.

Techniques: Clone Assay

Journal: Communications Biology

Article Title: Chd8 regulates X chromosome inactivation in mouse through fine-tuning control of Xist expression

doi: 10.1038/s42003-021-01945-1

Figure Lengend Snippet: a Schematic representation of the Chd8 expression construct. Protein domains are indicated. CAG promoter is shown (CAG P) in the red box. b Western Blot analysis of the Chd8 KO line (C4.1) and complemented cells. Top CDH8 and bottom loading control (GAPDH) blots are shown. c H3K27me3 IF analysis of Chd8 KO and complemented cells. Right representative images, left CTRL-normalized quantification of the number of cells having an Xi at 3 days of differentiation. To test for statistical significance, our data was fitted using Poisson regression method and multiple correction testing (* p ≤ 0.05). Data from two and three experiments are shown, n = 827. Single points represent independent biological samples. Standard error of the mean (SEM) is shown. d Top, schematic of Xist promoter and primers used for analysis (peaks 1–6). Bottom, qPCR analysis of YY1 Cut&Run qPCR analysis at the Xist promoter. Data from two experiments are shown. Single points represent independent biological samples. Matched input samples were used as normalization control. Sample names are shown in the legend. e Top, CTRL-normalised qRT-PCR analysis of scrambled siRNA (CTRL) and YY1 siRNA (YY1 KD ) in Chd8 KO.1 (KO.1 line). Tested genes are indicated. Statistical significance was tested by means of two-tailed unpaired t -test (* p ≤ 0.05). Data from three experiments are shown. Bottom, representative images of H3K27me3 in CTRL vs. YY1 KD cells (left) and the CTRL-normalised scoring of H3K27me3 domains (IF) is shown (right), n = 744. White arrows indicate examples of H3K27me3 domains. Statistical significance was tested by means of two-tailed unpaired t -test (* p ≤ 0.05). CTRL vs. YY1 KD , p -value = 0.00196. Data from three experiments is shown. Gapdh was used as internal normalization control. Single points represent independent biological samples.

Article Snippet: We purchased the FL Chd8 cDNA from Genescript and cloned it into the MreI and NotI sites of pCAGp292-Puro.

Techniques: Expressing, Construct, Western Blot, Control, Quantitative RT-PCR, Two Tailed Test

Journal: Communications Biology

Article Title: Chd8 regulates X chromosome inactivation in mouse through fine-tuning control of Xist expression

doi: 10.1038/s42003-021-01945-1

Figure Lengend Snippet: a Schematic representation of the Xist (blue) and Tsix genes (green). b Chd8 is crucial for correct Xist expression in undifferentiated and differentiating ESCs. CHD8 is shown in light-blue; Tsix -specific TF/remodelers are shown in green. Top, CHD8 localization at the Xist promoter is shown (light-blue peak). In undifferentiated conditions (Und), in the absence of CHD8, there is reduction of the basal transcription level of Xist (blue wavy lines), while Tsix transcription level is unaffected (green wavy lines). c Differentiating conditions in Chd8 KD and Chd8 KO background. Right, a mild Chd8 KD leads to a small reduction of Xist steady levels (KD). Complete and severe CHD8 depletions instead, lead to increased Xist expression and a further Tsix downregulation (blue wavy lines Xist , green wavy lines Tsix ). This condition also leads to a more-open chromatin state of the Xist regulatory regions, but not at Tsix ’s, during differentiation (light-brown peaks). We suggest that YY1 (green circle) and/or known (red circle) and yet-to-be-identified protein (purple circle with question mark) may bind to the Xist promoter in the absence of the CHD8 protein (red arrow) and strongly activate it. Left, WT situation is depicted.

Article Snippet: We purchased the FL Chd8 cDNA from Genescript and cloned it into the MreI and NotI sites of pCAGp292-Puro.

Techniques: Expressing